Host:

E.coli

Tag:

His-tag

AA Sequence:

AGCCTGACCAATCATACCGAAACCATTACCGTTGAAGAAGGCCAGACCCTGACCCTGAAATGTGTGACCAGTCTGCGTAAAAATAGTAGCCTGCAGTGGCTGACCCCGAGCGGCTTCACCATCTTCCTGAATGAATATCCGGCCCTGAAAAATAGCAAATATCAGCTGCTGCATCATAGCGCAAATCAGCTGAGCATTACCGTGCCGAATGTTACCCTGCAGGATGAAGGCGTGTATAAATGCCTGCATTATAGTGATAGTGTGAGCACCAAAGAAGTGAAAGTTATTGTGCTGGCAACCCCGTTCAAACCGATTCTGGAAGCAAGTGTTATTCGTAAACAGAATGGCGAAGAACATGTGGTTCTGATGTGTAGTACCATGCGTAGCAAACCGCCGCCGCAGATTACCTGGCTGCTGGGTAATAGCATGGAAGTGAGCGGCGGTACCCTGCATGAATTCGAAACCGATGGTAAAAAATGCAATACCACCAGCACCCTGATTATTCATACCTATGGTAAAAATAGCACCGTTGATTGTATTATTCGTCATCGTGGTCTGCAGGGTCGCAAACTGGTTGCACCGTTCCGCTTCGAAGATCTGGTGACCGATGAAGAAACCGCCAGCGATGCACTGGAACGCAATAGCCTGAGTAGCCAGGATCCGCAGCAGCCGACCAGCACCGTTAGCGTTACCGAAGATAGCAGCACCAGTGAAATTGATAAAGAAGAAAAAGAGCAGACCACCCAGGATCCGGATCTGACCACCGAAGCCAATCCGCAGTATCTGGGCCTGGCACGTAAAAAAAGCGGC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~40kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD355, mediates heterophilic cell-cell adhesion which regulates the activation, differentiation and tissue retention of various T-cell subsets. Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and IFNG/interferon-gamma secretion by CD8+ T-cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM1 in vivo. Regulates CD8+ T-cell proliferation in response to T-cell receptor (TCR) activation. Appears to be dispensable for CD8+ T-cell-mediated cytotoxicity. Interaction with SCRIB promotes the late phase of cellular polarization of a subset of CD4+ T-cells, which in turn regulates TCR-mediated proliferation and IFNG, IL17 and IL22 production. By interacting with CADM1 on CD8+ dendritic cells, regulates the retention of activated CD8+ T-cells within the draining lymph node (By similarity). Required for the intestinal retention of intraepithelial CD4+ CD8+ T-cells and, to a lesser extent, intraepithelial and lamina propria CD8+ T-cells and CD4+ T-cells (By similarity). Interaction with CADM1 promotes the adhesion to gut-associated CD103+ dendritic cells, which may facilitate the expression of gut-homing and adhesion molecules on T-cells and the conversion of CD4+ T-cells into CD4+ CD8+ T-cells (By similarity).

Note:

For research use only, not for use in diagnostic procedure.