Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD352 Recombinant Protein NCP0302

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGTTATCGTGCCCAGATTAGTACCAAAACCAGTGCAAAACTGAGCAGCTATACCCTGCGCATTCTGCGCCAGCTGCGTAATATTCAGGTGACCAATCATAGCCAGCTGTTCCAGAATATGACCTGTGAACTGCATCTGACCTGCAGCGTGGAAGATGCAGATGATAATGTGAGCTTCCGTTGGGAAGCCCTGGGCAATACCCTGAGCAGCCAGCCGAATCTGACCGTGAGCTGGGATCCGCGCATTAGTAGCGAACAGGATTATACCTGTATTGCAGAAAATGCAGTTAGTAATCTGAGCTTCAGCGTTAGTGCACAGAAACTGTGTGAAGATGTTAAAATTCAGTACACCGATACCAAAATG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~25kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecule (SLAM) family of immunomodulatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellular region and conserved tyrosine-based signaling motifs within its intracellular domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of multiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellular domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.

Note:

For research use only, not for use in diagnostic procedure.