CD344 Recombinant Protein NCP0299
Specifications
| 500ug/1mg price = 500ug |
Host:
E.coli
Tag:
His-tag
AA Sequence:
TTCGGCGATGAAGAAGAACGTCGCTGCGATCCGATTCGTATTAGTATGTGCCAGAATCTGGGTTATAATGTTACCAAAATGCCGAATCTGGTGGGCCATGAACTGCAGACCGATGCAGAACTGCAGCTGACCACCTTCACCCCGCTGATTCAGTATGGCTGTAGTAGTCAGCTGCAGTTCTTCCTGTGCAGTGTGTATGTGCCGATGTGCACCGAAAAAATTAATATTCCGATTGGTCCGTGTGGTGGCATGTGCCTGAGCGTGAAACGTCGTTGCGAACCGGTTCTGAAAGAATTCGGCTTCGCCTGGCCGGAAAGCCTGAATTGTAGTAAATTCCCGCCGCAGAATGATCATAATCACATGTGCATGGAAGGTCCGGGTGATGAAGAAGTTCCGCTGCCGCATAAAACACCTATTCAGCCGGGTGAAGAATGTCATAGTGTGGGCACCAATAGCGATCAGTATATCTGGGTTAAACGCAGTCTGAATTGCGTTCTGAAATGTGGTTATGATGCAGGCCTGTATAGC
Expression vector:
pet-22b(+)
Soluble:
PBS, 4M Urea, PH7.4
BiowMW:
~24kDa
Purification & Purity:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage & Stability:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Background:
Frizzled-4 is a 537 amino acid protein encoded by the human gene FZD4. Frizzled-4 acts as a receptor for Wnt proteins. Most frizzled receptors are coupled to the b-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of b-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-4 may be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Frizzled-4 also plays a critical role in retinal angiogenesis. Frizzled-4 is virtually ubiquitously expressed with greatest amounts found in adult heart, skeletal muscle, ovary, and fetal kidney
Note:
For research use only, not for use in diagnostic procedure.