Host:

E.coli

Tag:

His-tag

AA Sequence:

AGCGGTACCACCAATACCGTTGCCGCCTATAATCTGACCTGGAAAAGTACCAACTTCAAAACCATTCTGGAATGGGAACCGAAACCGGTTAATCAGGTGTATACCGTTCAGATTAGCACCAAAAGTGGTGATTGGAAAAGCAAATGCTTCTATACCACCGATACCGAATGCGATCTGACCGATGAAATTGTTAAAGATGTTAAACAGACCTACCTGGCACGCGTGTTCAGTTATCCGGCCGGCAATGTTGAAAGTACCGGCAGCGCAGGTGAACCGCTGTATGAAAATAGTCCGGAATTCACCCCGTATCTGGAAACCAATCTGGGCCAGCCGACCATTCAGAGCTTCGAACAGGTGGGTACCAAAGTTAATGTGACCGTTGAAGATGAACGTACCCTGGTTCGTCGCAATAATACCTTCCTGAGCCTGCGCGATGTGTTCGGCAAAGATCTGATCTATACCCTGTATTATTGGAAAAGCAGCAGTAGCGGCAAAAAAACCGCCAAAACCAATACCAATGAATTCCTGATTGATGTGGATAAAGGCGAAAATTATTGCTTCAGCGTTCAGGCAGTTATTCCGAGTCGCACCGTTAATCGCAAAAGTACCGATAGTCCGGTTGAATGCATGGGTCAGGAAAAAGGCGAATTCCGCGAA

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~35kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Tissue Factor (TF)/CD142 (Coagulation factor III/Thromboplastin) is a type-I transmembrane glycoprotein that serves as the cell surface receptor and cofactor for blood coagulation factors VII and VIIa, and thus plays a central role in hemostasis and thrombosis. The TF:VIIa receptor-ligand complex is widely recognized as the initiator of the extrinsic blood coagulation protease cascade, which ultimately leads to the generation of fibrin and thrombin. A member of the type-II cytokine receptor superfamily, TF has also been shown to engage the PI3K and MAPK signaling cascades upon binding to factor VIIa in order to drive cellular responses such as cell migration, growth, and proliferation. Although the function of TF under physiologic conditions is to coordinate blood clotting in response to tissue damage, TF is implicated in pathologic conditions such as tumorigenesis. Indeed, TF is aberrantly expressed in colorectal cancer, breast cancer, pancreatic cancer, and glioblastoma multiforme. It has been shown to promote tumor angiogenesis, tumor growth, metastasis, and venous thrombosis. Given that TF overexpression is associated with numerous types of solid tumors, it has garnered much attention as a potential therapeutic target.

Note:

For research use only, not for use in diagnostic procedure.