Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD135 Recombinant Protein NCP0262

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

AACCAGGATCTGCCGGTTATTAAATGTGTGCTGATTAATCATAAGAACAACGATAGCAGCGTGGGCAAAAGCAGCAGCTATCCGATGGTTAGCGAAAGTCCGGAAGATCTGGGTTGTGCACTGCGTCCGCAGAGTAGTGGCACCGTGTATGAAGCCGCCGCAGTGGAAGTTGATGTGAGTGCAAGTATTACCCTGCAGGTGCTGGTTGATGCCCCGGGCAATATTAGTTGTCTGTGGGTGTTCAAACATAGTAGCCTGAATTGTCAGCCGCACTTCGATCTGCAGAATCGCGGTGTGGTTAGTATGGTTATTCTGAAAATGACCGAAACACAAGCCGGCGAATATCTGCTGTTCATTCAGAGCGAAGCAACCAATTATACCATTCTGTTCACCGTGAGCATTCGTAATACCCTGCTGTATACCCTGCGTCGTCCGTACTTCCGCAAAATGGAAAATCAGGATGCCCTGGTGTGTATTAGCGAAAGCGTTCCGGAACCGATTGTGGAATGGGTGCTGTGCGATAGCCAGGGTGAAAGCTGTAAAGAAGAAAGTCCGGCAGTGGTGAAAAAAGAAGAAAAAGTTCTGCATGAACTGTTCGGCACCGATATTCGCTGCTGCGCACGTAATGAACTGGGTCGTGAATGTACCCGTCTGTTCACCATTGATCTGAATCAGACCCCGCAGACCACCCTGCCGCAGCTGTTCCTGAAAGTTGGCGAACCGCTGTGGATTCGTTGTAAAGCCGTGCATGTGAATCATGGCTTCGGTCTGACCTGGGAACTGGAAAATAAAGCACTGGAAGAAGGTAATTACTTCGAAATGAGTACCTATAGTACCAATCGTACCATGATTCGTATTCTGTTCGCATTCGTTAGCAGTGTTGCACGCAATGATACCGGCTATTATACCTGCAGCAGCAGTAAACATCCGAGCCAGAGCGCCCTGGTTACCATTGTTGAAAAAGGCTTCATTAATGCCACCAATAGTAGCGAAGATTATGAAATTGATCAGTATGAAGAGTTCTGCTTCAGTGTTCGCTTCAAAGCATATCCGCAGATTCGTTGTACCTGGACCTTCAGTCGCAAAAGCTTCCCGTGCGAACAGAAAGGCCTGGATAATGGTTATAGTATTAGCAAATTCTGCAACCATAAGCATCAGCCGGGTGAATATATCTTCCATGCAGAAAATGATGATGCCCAGTTCACCAAAATGTTCACCCTGAATATTCGTCGCAAACCGCAGGTTCTGGCAGAAGCCAGCGCCAGTCAGGCCAGCTGCTTCAGCGATGGTTATCCGCTGCCGAGTTGGACCTGGAAAAAATGCAGCGATAAAAGCCCGAATTGCACCGAAGAAATTACCGAAGGCGTGTGGAATCGCAAAGCCAATCGTAAAGTGTTCGGCCAGTGGGTTAGCAGTAGTACCCTGAATATGAGTGAAGCAATTAAAGGCTTCCTGGTTAAATGTTGCGCATATAATAGCCTGGGCACCAGCTGTGAAACCATTCTGCTGAATAGCCCGGGCCCGTTCCCGTTCATTCAGGATAATATTAGC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~57kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

FMS-related tyrosine kinase 3 (FLT3, also called Flk2), is a member of the type III receptor tyrosine kinase family, which includes c-Kit, PDGFR and M-CSF receptors. FLT3 is expressed on early hematopoietic progenitor cells and supports growth and differentiation within the hematopoietic system. FLT3 is activated after binding with its ligand FL, which results in a cascade of tyrosine autophosphorylation and tyrosine phosphorylation of downstream targets. The p85 subunit of PI3 kinase, SHP2, GRB2 and Shc are associated with FLT3 after FL stimulation. Tyr589/591 is located in the juxtamembrane region of FLT3 and may play an important role in regulation of FLT3 tyrosine kinase activity. Somatic mutations of FLT3 consisting of internal tandem duplications (ITDs) occur in 20% of patients with acute myeloid leukemia.

Note:

For research use only, not for use in diagnostic procedure.