CD132 Recombinant Protein NCP0260
Specifications
| 500ug/1mg price = 500ug |
Host:
E.coli
Tag:
His-tag
AA Sequence:
CTGAATACCACCATTCTGACCCCGAATGGTAATGAAGATACCACCGCCGACTTCTTCCTGACCACCATGCCGACCGATAGCCTGAGCGTTAGCACCCTGCCGCTGCCGGAAGTTCAGTGCTTCGTGTTCAATGTGGAATATATGAATTGCACCTGGAATAGTAGCAGCGAACCGCAGCCGACCAATCTGACCCTGCATTATTGGTATAAAAATAGTGATAACGACAAGGTTCAGAAATGCAGCCATTATCTGTTCAGCGAAGAAATTACCAGCGGTTGCCAGCTGCAGAAAAAAGAAATTCATCTGTATCAGACCTTCGTGGTGCAGCTGCAGGATCCGCGTGAACCGCGTCGCCAGGCCACCCAAATGCTGAAACTGCAGAATCTGGTGATTCCGTGGGCACCGGAAAATCTGACCTTACATAAACTGAGTGAAAGCCAGCTGGAACTGAATTGGAATAATCGCTTCCTGAATCATTGCCTGGAACATCTGGTTCAGTATCGTACCGATTGGGATCATAGTTGGACCGAACAGAGCGTTGATTATCGCCATAAATTCAGTCTGCCGAGTGTTGATGGTCAGAAACGCTATACCTTCCGTGTGCGCAGTCGCTTCAATCCGCTGTGCGGTAGCGCACAGCATTGGAGTGAATGGAGCCATCCGATTCATTGGGGTAGTAATACCAGCAAAGAAAATCCGTTCCTGTTCGCCCTGGAAGCC
Expression vector:
pet-22b(+)
Soluble:
PBS, 4M Urea, PH7.4
BiowMW:
~30kDa
Purification & Purity:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage & Stability:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Background:
The IL-2 receptor is a multicomponent complex consisting of three subunits, a, b and g, each of which is required for high affinity binding of IL-2. The a chain functions primarily in binding IL-2, whereas the b and g chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain high affinity ligand binding cytokine receptors. However, it is now well established that the IL-2R g chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Ra and IL-7Ra respectively, while the common subunit is referred to as gc. Although the common g chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own.There is evidence that the gc chain is also a subunit of IL-13R.
Note:
For research use only, not for use in diagnostic procedure.
