Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD117/KIT Recombinant Protein NCP0253

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGCCTAGTGTTAGCCCGGGTGAACCGAGCCCGCCGAGCATTCATCCGGGCAAAAGCGATCTGATTGTTCGTGTTGGTGATGAAATTCGTCTGCTGTGCACCGATCCGGGCTTCGTGAAATGGACCTTCGAAATTCTGGATGAAACCAATGAAAATAAGCAGAATGAATGGATTACCGAAAAAGCAGAAGCCACCAATACCGGCAAATATACCTGCACCAATAAACATGGTCTGAGTAATAGTATCTATGTGTTCGTTCGCGATCCGGCCAAACTGTTCCTGGTGGATCGTAGCCTGTATGGTAAAGAAGATAATGATACCCTGGTGCGCTGTCCGCTGACCGATCCGGAAGTTACCAATTATAGTCTGAAAGGTTGCCAGGGCAAACCGCTGCCGAAAGATCTGCGCTTCATTCCGGATCCGAAAGCAGGCATTATGATTAAAAGCGTTAAACGCGCATATCATCGTCTGTGTCTGCATTGCAGCGTGGATCAGGAAGGTAAAAGTGTTCTGAGCGAAAAATTCATTCTGAAAGTGCGCCCGGCATTCAAAGCAGTTCCGGTTGTGAGCGTGAGTAAAGCAAGTTATCTGCTGCGCGAAGGCGAAGAATTCACCGTGACCTGTACCATTAAAGATGTGAGTAGCAGCGTGTATAGTACCTGGAAACGTGAAAATAGTCAGACCAAACTGCAGGAAAAATATAATAGTTGGCATCATGGTGACTTCAATTATGAACGTCAGGCCACCCTGACCATTAGCAGCGCCCGCGTTAATGATAGCGGCGTGTTCATGTGTTATGCAAATAATACCTTCGGTAGCGCCAATGTGACCACCACCCTGGAAGTTGTGGATAAAGGCTTCATTAATATCTTCCCGATGATTAATACCACCGTGTTCGTGAATGATGGTGAAAATGTGGATCTGATTGTGGAATATGAAGCATTCCCGAAACCGGAACATCAGCAGTGGATCTATATGAATCGCACCTTCACCGATAAATGGGAAGATTATCCGAAAAGCGAAAATGAAAGCAATATTCGTTACGTGAGTGAACTGCATCTGACCCGCCTGAAAGGCACCGAAGGCGGCACCTATACCTTCCTGGTGAGTAATAGCGATGTGAATGCAGCAATTGCCTTCAATGTGTATGTGAATACCAAACCGGAAATTCTGACCTATGATCGCCTGGTGAATGGCATGCTGCAGTGCGTTGCAGCCGGCTTCCCGGAACCGACCATTGATTGGTACTTCTGCCCGGGTACCGAACAGCGTTGTAGCGCCAGTGTGCTGCCGGTGGATGTTCAGACCCTGAATAGCAGCGGCCCGCCGTTCGGTAAACTGGTTGTTCAGAGCAGTATTGATAGTAGTGCCTTCAAACATAATGGCACCGTGGAATGCAAAGCCTATAATGATGTGGGTAAAACCAGCGCATACTTCAACTTCGCCTTCAAAGGTAATAATAAAGAACAGATTCACCCGCATACCCTGTTCACCCCG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~55kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

c-Kit is a member of the subfamily of receptor tyrosine kinases that includes PDGF, CSF-1, and FLT3/flk-2 receptors. It plays a critical role in activation and growth in a number of cell types including hematopoietic stem cells, mast cells, melanocytes, and germ cells. Upon binding with its stem cell factor (SCF) ligand, c-Kit undergoes dimerization/oligomerization and autophosphorylation. Activation of c-Kit results in the recruitment and tyrosine phosphorylation of downstream SH2-containing signaling components including PLCγ, the p85 subunit of PI3 kinase, SHP2, and CrkL. Molecular lesions that impair the kinase activity of c-Kit are associated with a variety of developmental disorders, and mutations that constitutively activate c-Kit can lead to pathogenesis of mastocytosis and gastrointestinal stromal tumors. Tyr719 is located in the kinase insert region of the catalytic domain. c-Kit phosphorylated at Tyr719 binds to the p85 subunit of PI3 kinase in vitro and in vivo.

Note:

For research use only, not for use in diagnostic procedure.