IL-4R/CD124 Recombinant Protein NCP0241
Specifications
| 500ug/1mg price = 500ug |
Host:
E.coli
Tag:
His-tag
AA Sequence:
AAGGTGCTGCAGGAACCGACCTGCGTTAGTGATTATATGAGCATTAGCACCTGTGAATGGAAAATGAATGGTCCGACCAATTGCAGTACCGAACTGCGCCTGCTGTATCAGCTGGTGTTCCTGCTGAGCGAAGCACATACCTGTATTCCGGAAAATAATGGCGGCGCCGGCTGTGTGTGTCATCTGCTGATGGATGATGTTGTGAGCGCCGATAATTATACCCTGGATCTGTGGGCAGGCCAGCAGCTGCTGTGGAAAGGTAGCTTCAAACCGAGTGAACATGTTAAACCGCGCGCCCCGGGCAATCTGACCGTTCATACCAATGTTAGCGATACCCTGCTGCTGACCTGGAGCAATCCGTATCCGCCGGATAATTATCTGTATAATCATCTGACCTACGCCGTTAATATCTGGAGCGAAAATGATCCGGCAGACTTCCGTATCTATAATGTTACCTATCTGGAACCGAGCCTGCGTATTGCCGCAAGTACCCTGAAAAGTGGCATTAGTTATCGTGCCCGTGTGCGCGCCTGGGCCCAGTGCTATAATACCACCTGGAGCGAATGGAGCCCGAGTACCAAATGGCATAATAGCTATCGTGAACCGTTCGAACAGCAT
Expression vector:
pet-22b(+)
Soluble:
PBS, 4M Urea, PH7.4
BiowMW:
~25kDa
Purification & Purity:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage & Stability:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Background:
The IL-2 receptor is a multicomponent complex consisting of three subunits, α, β and γ, each of which is required for high affinity binding of IL-2. The α chain functions primarily in binding IL-2, whereas the β and γ chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain, high-affinity ligand-binding cytokine receptors. However, it is now well established that the IL-2Rγ chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Rα and IL-7Rα, respectively, while the common subunit is referred to as γc. Although the common γ chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own. There is evidence that the γc chain is also a subunit of IL-13R.
Note:
For research use only, not for use in diagnostic procedure.