Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

IL-13R/CD213a1 Recombinant Protein NCP0238

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

GGTGGTGGTGGTGCAGCCCCTACCGAAACACAACCGCCGGTTACCAATCTGAGTGTTAGCGTGGAAAATCTGTGTACCGTTATCTGGACCTGGAATCCGCCGGAAGGCGCAAGCAGCAATTGTAGCCTGTGGTACTTCAGTCACTTCGGCGATAAACAGGATAAAAAAATTGCACCGGAAACCAGACGTAGTATTGAAGTGCCGCTGAATGAACGCATCTGTCTGCAGGTTGGCAGCCAGTGTAGTACCAATGAAAGCGAAAAACCGAGCATTCTGGTTGAAAAATGTATTAGCCCGCCGGAAGGTGATCCGGAAAGTGCAGTTACCGAACTGCAGTGCATCTGGCATAATCTGAGCTATATGAAATGTAGCTGGCTGCCGGGTCGTAATACCAGTCCGGATACCAATTATACCCTGTATTATTGGCATCGTAGTCTGGAAAAAATTCATCAGTGCGAAAATATCTTCCGCGAAGGTCAGTACTTCGGTTGTAGCTTCGATCTGACCAAAGTGAAAGATAGCAGCTTCGAACAGCATAGCGTGCAGATTATGGTTAAAGATAATGCAGGTAAAATCAAGCCGAGCTTCAATATTGTGCCGCTGACCAGTCGTGTTAAACCGGATCCGCCGCATATTAAAAATCTGAGCTTCCATAATGACGATCTGTATGTTCAGTGGGAAAATCCGCAGAACTTCATTAGTCGCTGCCTGTTCTATGAAGTTGAAGTTAATAATAGCCAGACCGAAACACATAATGTGTTCTATGTTCAGGAAGCAAAATGTGAAAATCCGGAATTCGAACGTAATGTGGAAAATACCAGTTGCTTCATGGTGCCGGGCGTTCTGCCGGATACCCTGAATACCGTGCGCATTCGCGTTAAAACCAATAAACTGTGCTATGAAGATGATAAACTGTGGAGTAATTGGAGCCAGGAAATGAGCATTGGCAAAAAACGCAATAGTACC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~32kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

The Th2 cytokine Interleukin-13 (IL-13) plays a critical role in allergen-induced airway hyper-responsiveness (AHR). Two different receptors exist for IL-13, designated IL-13Ra1 and 2. IL-13Ra1 exists as a heterodimer of IL-13Ra1 and IL-4Ra as a signaling subunit, whereas IL-13Ra2 acts as a decoy receptor for IL-13. Furthermore, TNFa or IL-4 stimulation induces IL-13Ra2 upregulation, while IL-13Ra1 is constitutively expressed. Cell surface localization of IL-13Ra2 abrogates IL-13 signaling, thus IL-13 induced translocation of the receptor from the cytoplasm provides a mechanism for negative-feedback of IL-13 signaling. IL-13Ra1 expression is predominant in B cells, monocytes and T cells, whereas IL-13Ra2 expression is highest in glioma cells.

Note:

For research use only, not for use in diagnostic procedure.