Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD97 Recombinant Protein NCP0237

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGGATAGCCGCGGCTGCGCACGCTGGTGCCCTCAAAATAGTAGTTGCGTTAATGCAACCGCATGCCGTTGTAATCCGGGCTTCAGCAGCTTCAGCGAAATTATTACCACCCCGACCGAAACCTGTGATGATATTAATGAATGCGCAACCCCGAGTAAAGTGAGTTGCGGCAAATTCAGCGATTGCTGGAATACCGAAGGCAGCTATGATTGCGTGTGTAGCCCGGGCTATGAACCGGTGAGTGGCGCAAAAACCTTCAAAAATGAAAGCGAAAATACCTGTCAGGATGTGGATGAATGTCAGCAGAATCCGCGTCTGTGTAAAAGCTATGGCACCTGCGTTAATACCCTGGGTAGCTATACCTGCCAGTGCCTGCCGGGCTTCAAATTCATTCCGGAAGATCCGAAAGTGTGCACCGATGTTAATGAATGCACCAGTGGCCAGAATCCGTGTCATAGTAGTACCCATTGTCTGAATAATGTGGGCAGTTATCAGTGCCGTTGTCGCCCGGGCTGGCAGCCTATTCCGGGTAGTCCGAATGGTCCGAATAATACCGTGTGTGAAGATGTTGATGAATGCAGCAGTGGTCAGCATCAGTGCGATAGTAGCACCGTGTGCTTCAATACCGTGGGCAGTTACAGTTGTCGTTGCCGTCCGGGTTGGAAACCGCGTCATGGTATTCCGAATAATCAGAAAGATACCGTGTGTGAGGATATGACCTTCAGTACCTGGACCCCGCCGCCGGGTGTGCATAGCCAGACCCTGAGTCGCTTCTTCGATAAAGTGCAGGATCTGGGTCGTGATAGTAAAACCAGCAGTGCAGAAGTTACCATTCAGAATGTTATTAAACTGGTTGATGAGCTGATGGAAGCCCCGGGTGATGTTGAAGCACTGGCCCCGCCGGTGCGTCATCTGATTGCAACCCAGCTGCTGAGCAATCTGGAAGATATTATGCGCATTCTGGCCAAAAGCCTGCCGAAAGGCCCGTTCACCTATATTAGCCCGAGTAATACCGAACTGACCCTGATGATTCAGGAACGCGGTGATAAAAATGTTACCATGGGTCAGAGCAGTGCCCGCATGAAACTGAATTGGGCCGTTGCCGCCGGCGCAGAAGATCCGGGTCCGGCAGTGGCAGGCATTCTGAGTATTCAGAATATGACCACCCTGCTGGCCAATGCAAGTCTGAATCTGCATAGCAAAAAACAGGCCGAACTGGAAGAAATCTATGAAAGTAGTATTCGTGGTGTTCAGCTGCGTCGTCTGAGTGCCGTGAATAGCATCTTCCTGAGTCATAATAATACCAAAGAACTGAATAGCCCGATTCTGTTCGCATTCAGTCATCTGGAAAGCAGTGATGGCGAAGCAGGCCGTGATCCGCCGGCAAAAGATGTGATGCCGGGTCCGCGCCAGGAACTGCTGTGTGCCTTCTGGAAAAGTGATAGCGATCGTGGTGGCCATTGGGCCACCGAAGGTTGCCAGGTTCTGGGTAGTAAAAATGGTAGTACCACCTGCCAGTGTAGCCATCTGAGCAGCTTCGCAATTCTGATGGCCCATTATGATGTTGAAGATTGGAAACTGACCCTGATTACCCGT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~64kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD97 is a member of the EGF-TM7 (seven-span transmembrane) protein family, which is characterized by an extended extracellular region with a variable number of N-terminal EGF-like domains coupled to a TM7 stalk. It is expressed by leukocytes following activation. CD97 binds to its cellular ligand CD55 (decay accelerating factor) and protects several cell types from complement-mediated damage. The CD97-CD55 interaction may play a role in cellular activation, migration and adhesion following inflammation. CD97 expression is increased in thyroid cancer, paralleling dedifferentiation and tumor staging in this disease. Many colorectal cell lines are also CD97+, with CD97 levels correlating with migration and invasion in vitro. CD97 is also expressed in various gastric, pancreatic and esophageal carcinomas. CD97 shares significant homology with EMR2, however the two proteins exhibit different expression patterns, as EMR2 is not expressed in any of the aforementioned cancer cells.

Note:

For research use only, not for use in diagnostic procedure.