Host:

E.coli

Tag:

His-tag

AA Sequence:

CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~18kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

The T cell receptor (TCR) is a heterodimer composed of either a and b or γ and δ chains. CD3 chains and the CD4 or CD8 co-receptors are also required for efficient signal transduction through the TCR. The TCR is expressed on T helper and T cytotoxic cells that can be distinguished by their expression of CD4 and CD8. T helper cells express CD4 proteins and T cytotoxic cells display CD8. CD8 (also designated Leu 2 or T8), a cell surface glycoprotein, is a two chain complex (aa or ab) receptor that binds class I MHC molecules presented by the antigen-presenting cell (APC). A primary function of CD8 is to facilitate antigen recognition by the TCR and to strengthen the avidity of the TCR-antigen interactions. An additional role for CD8-expressing T cells may be to maintain low levels of HIV expression.

Note:

For research use only, not for use in diagnostic procedure.