Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD79A Recombinant Protein NCP0227

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CTGTGGATGCATAAAGTGCCGGCCAGCCTGATGGTTAGCCTGGGCGAAGATGCACACTTCCAGTGTCCGCATAATAGTAGTAATAATGCAAATGTGACCTGGTGGCGCGTGCTGCATGGTAATTATACCTGGCCGCCGGAATTCCTGGGTCCGGGTGAAGATCCGAATGGTACCCTGATTATTCAGAATGTTAATAAAAGCCACGGCGGTATCTATGTGTGTCGTGTTCAGGAAGGCAATGAAAGTTATCAGCAGAGCTGTGGTACCTATCTGCGTGTTCGTCAGCCGCCGCCGCGCCCGTTCTTAGATATGGGTGAAGGTACCAAAAATCGT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~15kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Antigen receptors found on the surface of B cells contain a heterodimeric signaling component composed of CD79A and CD79B, also known as Ig α and Ig β, respectively. Presence of this receptor complex is essential for B-cell development and function. Together these two proteins and the associated B cell receptor initiate intracellular signaling following antigen binding. An immunoreceptor tyrosine-based activation motif (ITAM) found in the CD79A intracellular region appears to be important for its function. Antigen binding precedes formation of the CD79A and CD79B heterodimer and subsequent activation of receptor associated kinases. Research has shown that CD79A is a marker for B-lineage lymphoblastic leukemia. Additionally, investigators have found that mutations in the CD79A (MB1) gene are associated with abnormally low levels of functional B cell receptors in some cases of chronic B cell lymphocytic leukemia.

Note:

For research use only, not for use in diagnostic procedure.