Host:

E.coli

Tag:

His-tag

AA Sequence:

CGTTATCTGCAGGTTAGTCAGCAGCTGCAGCAGACCAATCGTGTGCTGGAAGTTACCAATAGCAGCCTGCGCCAGCAGCTGCGCCTGAAAATTACCCAGCTGGGTCAGAGCGCAGAAGATCTGCAGGGCAGTCGTCGTGAACTGGCCCAGAGCCAGGAAGCACTGCAGGTGGAACAGCGTGCACATCAGGCCGCAGAAGGCCAGCTGCAGGCATGCCAGGCAGATCGTCAGAAAACCAAAGAAACCTTACAGAGTGAAGAACAGCAGCGTCGTGCCCTGGAACAGAAACTGAGCAATATGGAAAATCGCCTGAAACCGTTCTTCACCTGCGGTAGCGCCGATACCTGTTGCCCGAGTGGTTGGATTATGCATCAGAAAAGTTGCTTCTATATCAGTCTGACCAGCAAAAATTGGCAGGAAAGTCAGAAACAGTGCGAAACCTTAAGCAGTAAACTGGCCACCTTCAGTGAAATCTATCCGCAGAGCCATAGTTATTACTTCCTGAATAGCCTGCTGCCGAATGGCGGTAGCGGCAATAGTTATTGGACCGGTCTGAGCAGCAATAAAGATTGGAAACTGACCGATGATACCCAGCGTACCCGTACCTATGCACAGAGTAGTAAATGCAATAAAGTTCATAAGACCTGGAGCTGGTGGACCCTGGAAAGCGAAAGTTGTCGTAGTAGTCTGCCGTATATCTGTGAAATGACCGCATTCCGCTTCCCGGAT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~30kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD5 has been identified as a transmembrane glycoprotein that is expressed on 70% of normal peripheral blood lymphocytes and on virtually all T lymphocytes in thymus and peripheral blood. Activation of T cells through the T cell receptor (TCR) results in tyrosine phosphorylation of CD5, and the absence of CD5 renders T cells hyper-responsive to TCR-mediated activation. CD5 associates with the TCR/CD3 ζ chain, and with the Src family kinase, Lck p56. The C-type lectin superfamily member CD72 is a cell surface negative regulator of B cell activation from the pro-B through the mature B cell stage. CD72 serves as a receptor for CD5. The ability of lymphocytes to respond to antigenic or mitogenic stimulation utilizes both positive and negative regulatory proteins that influence the threshold for responsiveness. The human CD72 gene maps to chromosome 9p13.3 and encodes a transmembrane glycoprotein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM). Upon tyrosine phosphorylation, the CD72 ITIM recruits SH2-containing phosphatases such as SHP-1, resulting in downregulation of cell activation. CD72-/- mice contain hyperproliferative B cells.

Note:

For research use only, not for use in diagnostic procedure.