CD71/TfR Recombinant Protein NCP0225
Specifications
| 500ug/1mg price = 500ug |
Host:
E.coli
Tag:
His-tag
AA Sequence:
CAGAATGTTAAGCATCCGGTTACCGGCCAGTTCCTGTATCAGGATAGTAATTGGGCAAGCAAAGTGGAAAAACTGACCCTGGATAATGCAGCCTTCCCGTTCCTGGCATATAGTGGCATTCCGGCAGTGAGCTTCTGCTTCTGTGAAGATACCGATTATCCGTATCTGGGTACCACCATGGATACCTATAAAGAACTGATTGAACGTATTCCGGAACTGAATAAAGTTGCACGCGCAGCAGCCGAAGTGGCCGGTCAGTTCGTTATTAAACTGACCCATGATGTGGAACTGAATCTGGATTATGAACGCTATAATAGTCAGCTGCTGAGCTTCGTGCGTGATCTGAATCAGTATCGCGCAGATATTAAAGAAATGGGCCTGAGTCTGCAGTGGCTGTATAGTGCACGTGGCGACTTCTTCCGTGCCACCAGTCGCCTGACCACCGACTTCGGCAATGCAGAAAAAACCGATCGCTTCGTGATGAAAAAACTGAATGATCGTGTTATGCGCGTGGAATATCACTTCCTGAGCCCGTATGTGAGCCCGAAAGAAAGCCCGTTCCGTCATGTGTTCTGGGGCAGTGGCAGTCATACCCTGCCGGCACTGCTGGAAAATCTGAAACTGCGTAAACAGAATAATGGTGCATTCAATGAAACCTTATTCCGTAATCAGCTGGCCCTGGCAACCTGGACCATTCAGGGCGCCGCAAATGCACTGAGCGGC
Expression vector:
pet-22b(+)
Soluble:
PBS, 4M Urea, PH7.4
BiowMW:
~27kDa
Purification & Purity:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage & Stability:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Background:
Transferrin receptor 1 (CD71, TFRC) is a type II transmembrane receptor and carrier protein responsible for the uptake of cellular iron through receptor-mediated endocytosis. Neutral pH at the cell surface promotes binding of the iron-binding glycoprotein transferrin (Tf) to the CD71 receptor. The receptor-ligand complex enters the cell through receptor-mediated endocytosis and is internalized into an endosome. Relatively lower endosomal pH leads to a change in the local charge environment surrounding the iron-transferrin binding site and results in the release of iron. The receptor-ligand complex is recycled to the cell surface where transferrin dissociates from the CD71 receptor. Ubiquitously expressed transferrin receptor is continuously recycled and undergoes clathrin-mediated endocytosis regardless of ligand binding state. The interaction between receptor and ligand has been studied in detail. The helical domain of CD71 directly interacts with the transferrin C-lobe and induces a conformation change in Tf to facilitate the transport process. Interaction between the receptor CD71 and transferrin is mediated by the membrane protein hemochromatosis (HFE). HFE binds the α-helical domain of CD71, blocking formation of the CD71-transferrin complex and inhibiting iron uptake. In addition to binding transferrin, CD71 also interacts with H-ferritin at the cell surface and transports this intracellular iron storage protein to cellular endosomes and lysosomes. Additional studies indicate that the transferrin receptor is an evolutionarily conserved receptor for a number or arenaviruses and at least one retrovirus. Aberrant expression of CD71 is seen in a number of cancers, including thyroid carcinomas, lymphomas, and T-lineage leukemias, suggesting a possible therapeutic role for targeted inhibition of the transferrin receptor.
Note:
For research use only, not for use in diagnostic procedure.
