Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD66/CEACAM1 Recombinant Protein NCP0220

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGCTGACCACCGAAAGCATGCCGTTCAATGTGGCCGAAGGCAAAGAAGTTCTGCTGCTGGTTCATAATCTGCCGCAGCAGCTGTTCGGTTATAGTTGGTATAAAGGTGAACGCGTGGATGGTAATCGCCAGATTGTGGGTTATGCCATTGGTACCCAGCAGGCAACCCCGGGTCCGGCTAATAGTGGCCGCGAAACCATCTATCCGAATGCCAGCCTGCTGATTCAGAATGTTACCCAGAATGATACCGGCTTCTATACCCTGCAGGTGATTAAAAGTGATCTGGTTAATGAAGAAGCCACCGGTCAGTTCCATGTGTATCCGGAACTGCCGAAACCGAGCATTAGTAGCAATAATAGTAATCCGGTGGAAGATAAAGATGCAGTTGCCTTCACCTGTGAACCGGAAACACAAGATACCACCTATCTGTGGTGGATTAATAATCAGAGTCTGCCGGTTAGCCCGCGCCTGCAGCTGAGCAATGGTAATCGCACCCTGACCCTGCTGAGCGTTACCCGTAATGATACCGGTCCGTATGAATGCGAAATTCAGAATCCGGTTAGCGCAAATCGCAGCGATCCGGTTACCCTGAATGTTACCTATGGCCCGGATACCCCGACCATTAGTCCGAGCGATACCTATTATCGTCCGGGTGCAAATCTGAGTCTGAGCTGCTATGCAGCAAGCAATCCGCCGGCACAGTATAGCTGGCTGATTAATGGCACCTTCCAGCAGAGTACCCAGGAACTGTTCATTCCGAATATTACCGTTAATAATAGCGGTAGCTATACCTGTCATGCAAATAATAGTGTTACCGGTTGCAATCGTACCACCGTTAAAACCATTATTGTGACCGAACTGAGCCCGGTGGTTGCCAAACCGCAGATTAAAGCAAGTAAAACCACCGTTACCGGCGATAAAGATAGCGTTAATCTGACCTGTAGTACCAATGATACCGGAATTAGCATTCGTTGGTTCTTCAAAAATCAGAGCCTGCCGAGTAGCGAACGCATGAAACTGAGCCAGGGCAATACCACCCTGAGTATTAATCCGGTGAAACGTGAAGATGCCGGCACCTATTGGTGCGAAGTGTTCAATCCGATTAGTAAAAATCAGTCAGATCCGATTATGCTGAATGTTAATTATAACGCCCTGCCGCAGGAAAATGGTCTGAGCCCGGGC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~45kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CEACAM1 (also known as C-CAM and CD66a) is a member of CEA-related cell-adhesion molecule (CEACAM) subfamily of the carcinoembryonic antigen (CEA) family. CEACAM1 is expressed by certain epithelial, endothelial, lymphoid, and myeloid cells. Human CEACAM1 has many different splice variants; the abundance of CEACAM1 and the relative ratio of the different isoforms varies markedly among cell types and may be regulated in a context-dependent fashion. The isoforms with long (L) and short (S) cytoplasmic tails have different signaling properties. Notably, L isoforms contain a functional ITIM (immunoreceptor tyrosine-based inhibitory motif) and several serine and threonine residues that could serve as potential phosphorylation targets. The extracellular domain of CEACAM1 is heavily glycosylated, making its apparent molecular weight during electrophoresis much larger than its predicted size (57.6 kDa). CEACAM1 mediates intercellular adhesion through homo- and heterophilic interaction with other members of the CEACAM family. Studies indicate that CEACAM1 plays important roles in angiogenesis, neovascularization, insulin signaling, T cell signaling, and tumorigenesis. In addition, CEACAM1 can function as a receptor for several microbial pathogens.

Note:

For research use only, not for use in diagnostic procedure.