Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD63 Recombinant Protein NCP0219

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

GCTGGTTATGTGTTCCGTGATAAAGTTATGAGCGAATTCAATAATAACTTCCGTCAGCAGATGGAAAATTATCCGAAAAATAATCACACCGCAAGCATTCTGGATCGCATGCAGGCCGACTTCAAATGTTGTGGCGCAGCAAATTATACCGATTGGGAAAAAATTCCGAGCATGAGCAAAAATCGTGTGCCGGATAGCTGCTGCATTAATGTTACCGTTGGTTGCGGTATTAACTTCAATGAAAAAGCCATTCATAAGGAAGGTTGCGTTGAAAAAATTGGTGGTTGGCTGCGTAAAAATGTT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~11kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD63 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2). Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. CD63, like other tetraspanins, is enriched in exosomes. It is also a component of Weibel-Palade bodies found in endothelial cells. Research studies demonstrate several functions of CD63 in different cell types including roles in mast cell degranulation, VEGF signaling in endothelial cells, recruitment of leukocytes to endothelial cells, and endosomal sorting during melanogenesis.

Note:

For research use only, not for use in diagnostic procedure.