Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD5 Recombinant Protein NCP0214

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CGTCTGAGTTGGTATGATCCGGACTTCCAGGCACGCCTGACCCGCAGTAATAGTAAATGTCAGGGTCAGCTGGAAGTGTATCTGAAAGATGGCTGGCACATGGTGTGTAGCCAGAGCTGGGGTCGTAGCAGTAAACAGTGGGAAGATCCGAGCCAGGCCAGTAAAGTGTGTCAGCGTCTGAATTGTGGTGTGCCGCTGAGTCTGGGCCCGTTCCTGGTTACCTATACCCCGCAGAGCAGCATTATCTGTTATGGCCAGCTGGGTAGCTTCAGTAATTGTAGTCATAGTCGCAATGATATGTGCCATAGTCTGGGTCTGACCTGCCTGGAACCGCAGAAAACCACCCCGCCGACCACCCGTCCGCCGCCTACCACCACACCGGAACCGACCGCACCGCCGCGTCTGCAACTGGTTGCACAGAGCGGCGGCCAGCATTGTGCAGGCGTGGTGGAATTCTATAGCGGTAGCCTGGGCGGTACCATTAGTTATGAAGCACAGGATAAAACACAAGATCTGGAAAACTTCCTGTGTAATAATCTGCAGTGTGGCAGCTTCCTGAAACATCTGCCGGAAACCGAAGCCGGTCGTGCACAGGATCCGGGTGAACCGCGTGAACATCAGCCGCTGCCGATTCAGTGGAAAATTCAGAATAGTAGTTGCACCAGCCTGGAACATTGCTTCCGCAAAATTAAACCGCAGAAAAGCGGCCGCGTTCTGGCCCTGCTGTGTAGCGGCTTCCAGCCGAAAGTGCAGAGTCGCCTGGTTGGCGGTAGTAGTATCTGTGAAGGTACCGTTGAAGTTCGCCAGGGTGCACAGTGGGCAGCACTGTGCGATAGTAGTAGTGCCCGCAGCAGCCTGCGCTGGGAAGAAGTGTGTCGTGAACAGCAGTGTGGCTCAGTGAATAGTTATCGCGTTCTGGATGCAGGTGATCCGACCAGTCGTGGTCTGTTCTGTCCGCATCAGAAACTGAGCCAGTGTCATGAACTGTGGGAACGTAATAGCTATTGTAAAAAAGTGTTCGTTACCTGCCAGGATCCGAATCCG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~38kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD5 is a type-I transmembrane protein belonging to the scavenger receptor cysteine-rich (SRCR) family, characterized by the presence of at least one SRCR domain of 90-110 amino acids. CD5 is expressed by all mature T cells, the B-1a subset of mature B cells, and some leukemic B cells. Its expression is increased in regulatory T and B cells (Tregs/Bregs). Anergic T and B cells also have elevated CD5 expression. Elevated levels of CD5 are also found in many autoimmune disorders. CD5 is associated with the T cell receptor (TCR) and negatively modulates T cell activation and differentiation. CD5 expression on the tumor infiltrating T lymphocytes is inversely correlated with their antitumor activity. Recently it was reported that CD5 directly binds to IL6 and can mediate downstream signaling. CD5+ B cells promote tumor growth in animal models. Reagents targeting CD5 have been actively pursued as therapeutic interventions for cancer and other conditions.

Note:

For research use only, not for use in diagnostic procedure.