Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD34 Recombinant Protein NCP0202

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

AGTCTGGATAATAACGGCACCGCAACCCCGGAACTGCCGACCCAGGGCACCTTCAGCAATGTTAGCACCAATGTTAGCTATCAGGAAACCACCACCCCGAGCACCCTGGGCAGCACCAGCCTGCATCCGGTTAGCCAGCATGGTAATGAAGCAACCACCAATATTACCGAAACCACCGTTAAATTCACCAGCACCAGTGTTATTACCAGCGTGTATGGTAATACCAATAGCAGTGTGCAGAGTCAGACCAGCGTTATTAGTACCGTGTTCACCACCCCGGCAAATGTTAGCACACCGGAAACCACCCTGAAACCGAGTCTGAGTCCGGGCAATGTGAGTGATCTGAGTACCACCAGTACCAGTCTGGCAACCAGCCCGACCAAACCGTATACCAGTAGCAGCCCGATTCTGAGTGATATTAAAGCCGAAATTAAGTGTAGCGGCATTCGTGAAGTTAAACTGACCCAGGGTATCTGTCTGGAACAGAATAAAACCAGCAGCTGCGCCGAATTCAAAAAAGATCGCGGTGAAGGTCTGGCCCGCGTGCTGTGCGGCGAAGAACAGGCAGATGCAGATGCAGGTGCCCAGGTGTGTAGCCTGCTGCTGGCACAGAGTGAAGTTCGTCCGCAGTGCCTGCTGCTGGTGCTGGCAAATCGTACCGAAATTAGTAGCAAACTGCAGCTGATGAAAAAACATCAGAGCGATCTGAAAAAACTGGGCATTCTGGACTTCACCGAACAGGATGTGGCAAGTCATCAGAGTTATAGCCAGAAAACC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~34kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD34 is a type I transmembrane glycophosphoprotein expressed by hematopoietic stem/progenitor cells, vascular endothelium and some fibroblasts . CD34 expression has been the hallmark used to identify hematopoietic stem cells for many years. CD34+ hematopoietic stem cells expand and differentiate into all the lymphohematopoietic lineages upon cytokine or growth factor stimulation and lose CD34 expression upon differentiation. However, recent studies performed in various laboratories conflict with that convention. The extracellular domain of CD34 is homologous to CD43, a protein involved in cell-cell adhesion, and CD34 has been shown to function as a negative regulator of cell adhesion. CD34 associates with CrkL but not CrkII, is a substrate for PKC, and activation of PKC is coupled with surface expression of CD34.

Note:

For research use only, not for use in diagnostic procedure.