Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD276 Recombinant Protein NCP0197

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CTGGAAGTGCAGGTTCCGGAAGATCCGGTTGTTGCACTGGTTGGTACCGATGCAACCCTGTGTTGCAGCTTCAGTCCGGAACCGGGCTTCAGCCTGGCCCAGCTGAATCTGATCTGGCAGCTGACCGATACCAAACAGCTGGTTCATAGCTTCGCAGAAGGTCAGGATCAGGGCAGCGCATACGCTAATCGCACCGCCCTGTTCCCGGATCTGCTGGCACAGGGCAATGCCAGTCTGCGTCTGCAGCGCGTGCGCGTGGCCGATGAAGGCAGCTTCACCTGCTTCGTTAGCATTCGCGACTTCGGTAGTGCAGCAGTGAGCCTGCAGGTTGCCGCCCCGTATAGTAAACCGAGCATGACCCTGGAACCGAATAAAGATCTGCGTCCGGGCGATACCGTTACCATTACCTGCAGTAGTTATCAGGGTTATCCGGAAGCCGAAGTGTTCTGGCAGGATGGCCAGGGCGTTCCGCTGACCGGCAATGTTACCACCAGTCAGATGGCAAATGAACAGGGCCTGTTCGATGTTCATAGCATTCTGCGTGTGGTGCTGGGCGCAAATGGTACCTATAGTTGCCTGGTGCGTAATCCGGTGCTGCAGCAGGATGCACATAGCAGTGTGACCATTACCCCGCAGCGTAGTCCGACCGGCGCAGTTGAAGTGCAGGTGCCGGAAGATCCTGTGGTTGCCCTGGTTGGTACAGATGCAACCTTACGCTGCAGCTTCAGCCCGGAACCGGGCTTCAGTCTGGCCCAGTTAAATCTGATCTGGCAACTGACCGATACAAAACAGCTGGTGCATAGCTTCACCGAAGGTCGCGATCAGGGCTCAGCCTATGCCAATCGTACCGCCCTGTTCCCTGATCTGCTGGCGCAGGGCAATGCGAGTCTGCGTCTTCAGCGCGTGCGTGTGGCAGATGAAGGTAGCTTCACCTGCTTCGTGAGTATTCGCGACTTCGGCAGTGCAGCCGTTAGTCTGCAGGTGGCAGCACCGTATAGCAAACCGAGTATGACCCTGGAGCCGAATAAAGACCTGCGCCCGGGCGATACAGTGACCATTACATGCAGCAGTTATCGCGGCTATCCGGAAGCGGAAGTGTTCTGGCAAGATGGCCAGGGTGTGCCGCTGACCGGTAATGTTACCACAAGTCAGATGGCCAATGAACAGGGTCTGTTCGATGTGCATAGTGTTCTGCGTGTGGTTCTGGGCGCCAATGGTACCTACAGCTGCCTGGTGCGCAATCCGGTTCTGCAGCAGGACGCCCATGGTAGTGTTACCATTACAGGTCAGCCGATGACCTTCCCGCCGGAAGCC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~48kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

B7 homolog 3 (B7-H3, CD276) is a member of the B7 family of cell surface ligands that regulate T cell activation and immune responses. B7-H3 protein contains two extracellular Ig-like V-type domains and two IgG-like C2-type domains, a transmembrane domain, and a short intracellular domain. Early research examining the biological process of B7-H3 suggested that B7-H3 is a positive regulator of T cell response. Subsequent research studies indicated that B7-H3 is a negative regulator of T cell response, and that the protein inhibits T cell proliferation. One possibility is that B7-H3 interacts with two distinct sets of receptors, resulting in seemingly opposite biological outcomes. B7-H3 is expressed by antigen presenting cells, activated T cells, and a few normal tissues, including placenta and prostate. Expression of B7-H3 is seen in several cancer types, including prostate, breast, colon, lung, and gastric cancers, and in endothelial cells from tumor associated vasculature.

Note:

For research use only, not for use in diagnostic procedure.