Host:

E.coli

Tag:

His-tag

AA Sequence:

GAAGAACAGCTGAGCTTCCGTATGCTGCAGACCAGTAGCTTCGCAAATCATAGCTGGGCACATAGTGAAGGCAGCGGTTGGCTGGGCGATCTGCAGACCCATGGTTGGGATACCGTGCTGGGTACCATTCGCTTCCTGAAACCGTGGAGCCATGGCAACTTCAGTAAACAGGAACTGAAAAATCTGCAGAGTCTGTTCCAGCTGTACTTCCATAGCTTCATTCAGATTGTGCAGGCCAGTGCAGGCCAGTTCCAGCTGGAATATCCGTTCGAAATTCAGATTCTGGCAGGCTGTCGTATGAATGCCCCGCAGATCTTCCTGAATATGGCATATCAGGGTAGCGACTTCCTGAGCTTCCAGGGCATTAGCTGGGAACCGAGCCCGGGTGCAGGCATTCGCGCACAGAATATCTGTAAAGTGCTGAATCGTTATCTGGATATTAAAGAAATCCTGCAGAGCCTGCTGGGTCATACCTGTCCGCGCTTCCTGGCAGGTCTGATGGAAGCAGGTGAAAGCGAACTGAAACGTAAAGTGAAACCGGAAGCATGGCTGAGTTGCGGTCCGAGTCCGGGTCCGGGCCGTCTTCAGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTGATGTGGATGCGTGGTGAACAGGAACAGCGCGGCACCCAGCGCGGCGATGTTCTGCCTAATGCAGATGAAACCTGGTATCTGCGTGCCACCCTGGATGTTGCCGCAGGCGAAGCAGCCGGTCTGAGCTGTCGTGTGAAACATAGCAGTCTGGGTGGTCATGATCTGATTATTCATTGGGGTGGTTAT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~30kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

The human CD1 family consists of five chromosome 1-localized genes which encode proteins that are involved in mediating the presentation of lipid antigens of microbial or self origin on the surface of immune cells. CD1E, also known as R2 or CD1A, is a 322 amino acid single-pass type I membrane protein that localizes to the lumen of the endoplasmic reticulum, as well as to the Golgi apparatus and contains one Ig-like domain. Expressed in a variety of tissues and on cortical thymocytes, dendritic cells and Langerhans cells, CD1E exists as a heterodimer with β-2-microglobulin and is necessary for the presentation of glycolipid antigens on the cell surface. CD1E is subject to posttranslational mono-ubiquitination and may also be proteolytically cleaved in endosomes to yield a soluble protein. CD1E is present on the surface of some T cell leukemias, suggesting a possible role in tumorigenesis.

Note:

For research use only, not for use in diagnostic procedure.