Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGCTGTTCCATCTGCAGAAAGAACTGGCAGAACTGCGTGAAAGTACCAGCCAGATGCATACCGCAAGCAGTCTGGAAAAACAGATTGGCCATCCGAGCCCGCCGCCGGAAAAAAAAGAACTGCGCAAAGTTGCCCATCTGACCGGCAAAAGTAATAGTCGCAGTATGCCGCTGGAATGGGAAGATACCTATGGCATTGTGCTGCTGAGCGGTGTGAAATATAAAAAAGGCGGCCTGGTTATTAATGAAACCGGCCTGTACTTCGTGTATAGTAAAGTGTACTTCCGTGGTCAGAGCTGCAATAATCTGCCGCTGAGTCATAAAGTGTATATGCGTAATAGTAAGTACCCGCAGGATCTGGTTATGATGGAAGGTAAAATGATGAGTTATTGTACCACCGGTCAGATGTGGGCCCGCAGTAGCTATCTGGGTGCCGTGTTCAATCTGACCAGTGCCGATCATCTGTATGTGAATGTTAGCGAACTGAGCCTGGTTAACTTCGAAGAAAGCCAGACCTTCTTCGGCCTGTATAAACTG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~20kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regulation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a result of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resulting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form.

Note:

For research use only, not for use in diagnostic procedure.